Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10015C4
Clone ID IST10015C4
Vector VICTR75
Project tigm

Sequence tag IST10015C4BBF1
Sequence
CCTTCGCCTTGCTCTGTATCATGTAGGACTGGGAGGCATTGACAGTGAGCAGGCGGTCTTCCGGCATGTTTCACCCGTGC
CATTCCGAGCCCGACTCGCCTTGTCTGGTTTTTGAGCTTCTAAGGGGAGCGCACGAGTAGAGACGAACCCTGCTGAATAA
TCTCAGTTCTGTCTTCCCGCCTAGTGCCTTCCTAGGGGAAGTCTTGGCCAAGACAGGACCTTCCTCTTTCTCAAACCTT
Sequence Type genomic DNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29683159..29683397 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]


Sequence tag IST10015C4HMF1
Sequence
CCTTCGCCTTGCTCTGTATCATGTAGGACTGGGAGGCATTGACAGTGAGCAGGCGGTCTTCCGGCATGTTTCACCCGTGC
CATTCCGAGCCCGACTCGCCTTGTCTGGTTTTTGAGCTTCTAAGGGGAGCGCACGAGTAGAGACGAACCCTGCTGAATAA
TCTCAGTTCTGTCTTCCCGCCTAGTGCCTTCCTAGGGGAAGTCTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29683159..29683368 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es