Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P116C10
Clone ID P116C10
Vector ROSAbetageo0
Project ggtc

Sequence tag P116C10
Sequence
AACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGGAG
Sequence Type mRNA
Unitrap ID UNI5036 UNI5037 UNI5038 UNI5039 UNI10782 UNI11424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94464949..94464988 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041929 (CT573086.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41753593..41753632 40
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8784192..8784231 40
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122517126..122517165 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066538 (AC164315.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59269268..59269307 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020111 (Cbara1) NM_144822 calcium binding atopy-related autoantigen 1 Gene [Source:MGI Symbol;Acc:MGI:2384909]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538903..114538942 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 72929710..72929749 40
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66639845..66639884 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12159946..12159985 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060989 (AL805912.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285354..54285393 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702044..77702083 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75497341..75497380 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9564623..9564662 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081441 (AC103620.12)  


SPLK-Sequence tag 5SP116C10
Sequence
AATTTTGTGTGTATAGAGATGCTTTTTGTGTATTGTCAAATTCATTTATGCGAGGCTTGAATAAAGGGGTTTTACGTGAA
TTTGGGTAGTTGGGTTTCTGGTATGTGGCTGTCTGCATATTGAATGTTCTAACTAATATTTCCAGAAGTTGGAAGAAAGT
GAGCCCCCTTTAAGGGCTTGTGTTGAATTGTCTTAATGCGTTCATTAAAAGCGGTTCACTCGAAAGT
Sequence Type genomic DNA
Unitrap ID UNI29497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75498359..75498585 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]


SPLK-Sequence tag 3SP116C10
Sequence
ATTCGAAATAACTTGAAACTATATGATGTAAGTGGGTATAACCAAGGTAAATTGATTACAGAAAGCTAAGGAGTGGAACC
AG
Sequence Type genomic DNA
Unitrap ID UNI29497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75498724..75498805 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]

 
Come back to gene ENSMUSG00000059005


For any suggestions or comments, please send an email to unitrap@crg.es