Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13190G2
Clone ID IST13190G2
Vector VICTR74
Project tigm

Sequence tag IST13190G2BBF1
Sequence
ATAACAAAACAAAAAATTTGGCTGGTGACACAGTTGAGCAGGTAGGACTTGCGTTTCCAAGCCTGGTAGCTGATTGCAAT
CTCTGGGACCCTCATAGTAGGAGAGACCCAATCCCTCCAGGTTGTCCTTCAGCCTACATACATGTCTGCACTGTGTGAAT
GACACCCTCCCCCACGGGACAAACAGCGAAGGGATGTANTCNACATAAGAAATAATAGCACAGCAAAGCCAGGCAGGCTG
ATTTATGCCTGTAATCCCANAGACTGAGGCAAGAGGATTGCATGGAGTTGGGAGCCAGCCTGGGCTCCACAGGAAGGCCC
TATTAAAAAAAAAAAAANNCCCAAN
Sequence Type genomic DNA
Unitrap ID UNI21005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168514151..168514494 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]


Sequence tag IST13190G2HMF1
Sequence
ATAACAAAACAAAAAATTTGGCTGGTGACACAGTTGAGCAGGTAGGACTTGCGTTTCCAAGCCTGGTAGCTGATTGCAAT
CTCTGGGACCCTCATAGTAGGAGAGACCCAATCCCTCCAGGTTGTCCTTCAGCCTACATACATGTCTGCACTGTGTGAAT
GACACCCTCCCCCACGGGACAAACAGCGAAGGGATGTAGTCC
Sequence Type genomic DNA
Unitrap ID UNI21005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168514294..168514494 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es