Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117F10
Clone ID P117F10
Vector ROSAbetageo0
Project ggtc

Sequence tag P117F10
Sequence
CGGCAGGGCTCTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGG
CATTCGCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444754 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SP117F10
Sequence
GTGTGCCCTACCATGCCCAGTTCAAGTGATCTTGTAAACTAGGGATTCTTAAACTTTCCACCTACAACCACTTTATGCAT
AAGGATTTTTTTTTTAAGTTTTATTT
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443008..180443113 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es