Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120A04
Clone ID M120A04
Vector ROSAbetageo0
Project ggtc

Sequence tag M120A04
Sequence
AGACGGCGGCGGCCATGTTTGTGGCGCGCAGCATCGCGGCGGACCACAAGGACCTCATCCACGATGTGTCTTTCGACTTC
CACGGGCGCCGGATGGCCACCTGCTCCAGCGATCAGAGCGTCAAG
Sequence Type mRNA
Unitrap ID UNI11425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67934650..67934774 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079614 (Seh1l) NP_082388 SEH1-like (S. cerevisiae Gene [Source:MGI Symbol;Acc:MGI:1919374]

 
Come back to gene ENSMUSG00000079614


For any suggestions or comments, please send an email to unitrap@crg.es