Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M124A12
Clone ID M124A12
Vector ROSAbetageo0
Project ggtc

Sequence tag M124A12
Sequence
TCCAAGCCTGCCTGAAAATGTCATACTTCGGCCTGGAGACTTTCAACGAG
Sequence Type mRNA
Unitrap ID UNI11427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48310603..48310652 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]


SPLK-Sequence tag 3SM124A12
Sequence
ATAGATGNNAGTCAAAGTGGTAAATAACAACGTTCTCTGGCGATCAAACGAGGAGCAGCTAGCTTCAGAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es