Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117B10
Clone ID P117B10
Vector ROSAbetageo0
Project ggtc

Sequence tag P117B10
Sequence
GCCACCGCCACCGCCACCAGCGCAGCTGTGCCACAGCCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCC
GTGTCCTCG
Sequence Type mRNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 65887183..65887271 87
 
EST/CDNA Est Name
  AK169767.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062568..30062656 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 5SP117B10
Sequence
TCCCCTAATGAGCGTGGGAGGGAGAAATGGACCATTTTCTCCTGAAGCCACAGTGTACTGTTTCTGAGTGCTCCCCAAGC
ATGTTTAAGTCTGCTAAAAATCCTTTTTTTGGAGGTGGTGGTGGTGGGGGAGCCTGGAGACTGACTTAGTAGATAAGCCA
GCTAGTAGCTAGTTGGATTTGTTTG
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30064949..30065133 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es