Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11770B1
Clone ID IST11770B1
Vector VICTR76
Project tigm

Sequence tag IST11770B1BBF1
Sequence
ACTTGACTTCACCTGTGAGACCTGACTTCTCACACACCTACATATGATGGCTTAAAACAGCTCCTTACTGAGCAATCTTC
CAAATGATTTATTTAGTCTGAGCCCACCATTTTGAAGTGAACTTGAAAATCATAAGCTGTTAACTGGGAAGGTCCCATGG
GTTTCCAAAATTATTAACTTGTAATCATTAAACCTCACCTCCCCTTCTCGGGAAACGAGAGGCGTTAATGAAAAGTAGTT
GTGCCTCCATAAACCTTTTGTCTGTGTGGTTTCAGTGTTGTTTGCTCCGTTCTGTTAACGAGGCCATATTTTCAGGGCTT
GTGGGATCTTTCTGTGTAAACTTGGGGACAGGCACACCTGCTGACTTTTCTGTTTATTCTTACATGCTCAGTACTTCTCC
TGTCATTGCTTGTAAATGAACACGGGCGATTTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46055995..46056432 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]


Sequence tag IST11770B1HMF1
Sequence
ACTTGACTTCACCTGTGAGACCTGACTTCTCACACACCTACATATGATGGCTTAAAACAGCTCCTTACTGAGCAATCTTC
CAAATGATTTATTTAGTCTGAGCCCACCATTTTGAAGTGAACTTGAAAATCATAAGCTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI29579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46055995..46056138 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es