Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050B7
Clone ID IST15050B7
Vector VICTR80
Project tigm

Sequence tag IST15050B7HMR1
Sequence
ATGTACATGGCTTGTTCTCATGGCTTGCTCAGCCTGCCTTCTTAGATCATCAGAAACCTCCCATCCAGGGGTTTCACAAC
CCATAGTGAGATGACCCACATCAATCCTTAGTTGGGAAAGTACTCCCCAAGGCTTGCCCACAAACCAATCTGATAGAGAC
ATTTTCTCAATTGAGGTTTCCTCCCAAATGATTCTAGCTTGTGGCAAATTGACATAAAACTAGCCAGCACATTTAGGTAT
AACCCTTTAAAGTGTCAAAAAATAAAGAACAACTTGTTGATGATTAGTTTTTATTAGTAATATGTCC
Sequence Type genomic DNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8524670..8524975 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]


Sequence tag IST15050B7BBF1
Sequence
TACATGAGCGCACACACATAAGCACTCATGGTCCTTCATCAGCTCCTGCTTCCATGTTCCTTTCCTGACATCCATCAATG
GTCGCTGTGATGTANAGCTGTAAACAAACGGAACAAACCACTTCTTCCTCAAGATTGTTTGTACTGAGGTGTTTTATTAC
AGCAATAGAAAGAGGATACTAAGGATGTGGAAATTCAATTCTTACAATTCCTCTTCTTTAAGAAACATTCTTTCATTACT
TTATTAAATCTGTGTGTGTGCATTGACAGTTTCCTCCCTAAATCCTTTCACTGAACTCCTCAATAAACCACGTTTTCTTC
CCAACAACACCCTCATTTCATAACTAATTTTTGTTTGTTTGTAGCTCACTATATGCTTCTATAACTTATTTCACTCTTAC
CACAAAACTAGCAAATACAATCAGAACCTACATTTTGTTCAAGGAGANTGTNNNTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8524224..8524674 447
NO GENE  


Sequence tag IST15050B7HMF1
Sequence
TACATGAGCGCACACACATAAGCACTCATGGTCCTTCATCAGCTCCTGCTTCCATGTTCCTTTCCTGACATCCATCAATG
GTCGCTGTGATGTAGAGCTGTAAACAAACGGAACAAACCACTTCTTCCTCAAGATTGTTTGTACTGAGGTGTTTTATTAC
AGCAATAGAAAGAGGATACTAAGGATGTGGAAATTCAATTCTTACAATTCCTCTTCTTTAAGAAACATTCTTTCATTACT
TTATTAAATCTGTGTGTGTGCATTGACAGTTTCCTCCCTAAATCCTTTCACTGAACTCCTCAATAAACCACGTTTTCTTC
CCAACAACACCCTCATTTCATAACTAATTTTTGTTTGTTTGTAGCTCACTATATGCTTCTATAACTTATTTCACTCTTAC
CACAAAACTAGCAAATACAATCAGAACCTACATTTTGTTCAAGGAGACTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8524224..8524674 451
NO GENE  

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es