Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123B03
Clone ID M123B03
Vector ROSAbetageo0
Project ggtc

Sequence tag M123B03
Sequence
GGGTCGGCGGCGTGGCAAGAGGACAGGGCTATGGAGAAGCTGCGGCGCGTCTTGAGCGGCCAGGACGACGAGGAGCAAGG
CCTGACGGCGCAG
Sequence Type mRNA
Unitrap ID UNI4921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45865734..45865826 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069899 (OTTMUSG00000005486) NP_598875 predicted gene, OTTMUSG00000005486 Gene [Source:MGI Symbol;Acc:MGI:3650635]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8504058..8504150 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073468 (Sft2d1) SFT2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918689]

 
Come back to gene ENSMUSG00000073468


For any suggestions or comments, please send an email to unitrap@crg.es