Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14297G2
Clone ID IST14297G2
Vector VICTR74
Project tigm

Sequence tag IST14297G2HMR1
Sequence
NNNAGCCCAGAATGTGTCCNTCACTCCTGAGAGCTTCCTTATATCCCCACCTGCAGTGATCTTCTGCGACATTTTCCAGA
ATCTAATATGAATGAAATTACCCCATCTGAACCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26736093..26736207 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]


Sequence tag IST14297G2HMF1
Sequence
AGGATGACATAATGGTATGCACACAGCAATAATAGGTGACACATANNNNNNTGTCATGTTCAGGCCNATAAATTGAATAA
CGGTCATGATTATAATGTATCAAATAACGTAATATAATCCAGGCCTTCCAAACCACAGCCATGCTGAACAAACAATGGTA
GACCACCTGCTAGACAAACAACACTTCTTCCGAATCTTTTACAATATCTATTTCTAGGTCATGGAACAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26735862..26736092 217
 
EST/CDNA Est Name
  AV010154.1


Sequence tag IST14297G2BBF1
Sequence
TTAGGATGACATAATGGTATGCACACAGCAATAATAGGTGACACATAACTATGTGTCATGTTCAGGCCAATAAATTGAAT
AACGGTCATGATTATAATGTATCAAATAACGTAATATAATCCAGGCCTTCCAAACCACAGCCATGCTGAACAAACAATGG
TAGACCACCTGCTAGACAAACAACACTTCTTCCGAATCTTTTACAATATCTATTTCTAGGTCATGGAACAGTTGACGGGG
CAAAGTTCTGTCTTCCAGAAGGANTTCCAAGAGTAAATGCAGATCCTATGANGATCAGAAGANTGACCTTGCACAAGCTC
TCCTGTCCAGGGGATACCCATGGAGCATGGGAACCTTANACAGACAAGCCAGGCCACTGTGCCNTCACTGCAAGTCTCAN
GGACACCAGCGCAAAAGCACAGCACTACCAGAAAAACTTCTTGGTAAGAGAACCNACCTTGGNCCCNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26735625..26736093 451
 
EST/CDNA Est Name
  AV010154.1

 
Come back to gene AV010154.1


For any suggestions or comments, please send an email to unitrap@crg.es