Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117A04
Clone ID P117A04
Vector ROSAbetageo0
Project ggtc

Sequence tag P117A04
Sequence
TTTTTTCCGCCTTCCTTCTGCAACAGGCGTGGGTCACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGAT
CTCCGCACA
Sequence Type mRNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472657..127472739 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


SPLK-Sequence tag 5SP117A04
Sequence
GCCATCCTCGCCTGCTGCCAGCTTTGCGGCACCGGGCATTTAAGTTTAACATCGCTGGCGGCTCTGTGGGGCTCAGCGTT
CTTAGCTTGCCCCCGCGCCTGCGGGCAAAATGGGGTCTGCGCTTTGGGTCCCAGCAACAGCAGGACAGGAGGGCCCCGGG
TCCGGCTCCCGGTTTAAGGCGTGGGGACGCGGGAACCATTGCGGTGGAGCCGGAGAGGCTGGGCGCGTCTGCAGTTGGGA
AGGGCGCCACGGGGATCTGGACGAGGAGGTTAAGGGGGTCACAGCCTTAACTCGCAGCGTCGCTCGTCCTGGGGCCCCCC
GTGTTCTTCTTGCTCTGCGAAGTGGTCCTTAGCGAGTCGGGGGGTCCCAGACTCAGCGGCGTGAAGGTGGGGACCGGAAG
GGGGCCCAGAGTAGCGCCTGGACGCTCACGGTTAGGAGTCAGACCTTGGGATTGCTGCCCTTGTGGGATCGATCGGAAGA
GTGACCAACGAGGATCTGGCCAGGGCGAAGTCAGCTCTCTGCTAAGTGAAGCGCNNNCGCGAGGTCAGATCCTCTGAGCA
GGCGTCCCA
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472775..127473342 553
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


SPLK-Sequence tag 3SP117A04
Sequence
AGGCGTGGCGATTTGACCCGATTCAGGTGCTTTGGGGAGGTTGTCCGGATCCTCGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es