Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12078A1
Clone ID IST12078A1
Vector VICTR76
Project tigm

Sequence tag IST12078A1BBF1
Sequence
ATACTACAGTGACTTCTCTGTAGACTACAGTAGATACTTTCTGTCTGCCTTACTGAGAGAAGAGCTGGATTATATGCCCC
ATTCATTCCTTATGTGATTTTTGACACCCTTCCTGCCCTCAGACAGTAAGATGACTAATCTAGCTGATTTTTTTTTTTTT
N
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15126427..15126586 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]


Sequence tag IST12078A1HMF2
Sequence
NTACTACAGTGACTTCTCTGTAGACTACAGTAGATACTTTCTGTCTGCCTTACTGAGAGAAGAGCTGGATTATATGCCCC
ATTCATTCCTTATGTGATTTTTGACACCCTTCCTGCCCTCAGACAGTAAGATGACTAATCTAGCTGATTTTTTTTTTTTT
NGNNCCNGAN
Sequence Type genomic DNA
Unitrap ID UNI31981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15189099..15189266 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036552 (2210404J11Rik) NM_001034891 RIKEN cDNA 2410011O22 gene Gene [Source:MGI Symbol;Acc:MGI:1925733]

 
Come back to gene ENSMUSG00000036552


For any suggestions or comments, please send an email to unitrap@crg.es