Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14615E4
Clone ID IST14615E4
Vector VICTR74
Project tigm

Sequence tag IST14615E4HMF1
Sequence
CAGCAAAGCCAAGAATGAAGCTATAAACCCTGACATTTTGTGTTATGCACTGAGAGGATTTTAATAGACCTCGTTCCCTC
TTCTCCAGTCCTCCTCTTCTCTCCCTCTTCACCACCCCCATCACATCCAGTGTCCCACAGAGCACCCCTCCATTCCATTT
TGCCTGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286761..148286981 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14615E4BBF1
Sequence
CAGCAAAGCCAAGAATGAAGCTATAAACCCTGACATTTTGTGTTATGCACTGAGAGGATTTTAATAGACCTCGTTCCCTC
TTCTCCAGTCCTCCTCTTCTCTCCCTCTTCACCACCCCCATCACATCCAGTGTCCCACAGAGCACCCCTCCATTCCATTT
TGCCTGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGCCAGATGCCCCCCTCCCCACACC
TTCTTGGTTTTGATCTTTCCTGTTGTCCCTCTTCAAACCCCCCTTGCCTCCCTCCACCGTCCACTTTCTCACCTCCTTTT
TTTGGGTCCTGATCTCACAGCCTGTCCCTTANCTGCGGCTGTCCCAGTTGTCAGGGACAGCAGGTGGCTGTCCTTGTGCT
CTTTGTGCTCATAACATTTCCNGACAGACTTGANAGCGGGTGTANGNANTTTGN
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286761..148287213 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14615E4HMR1
Sequence
NCTGGGACTGAGAACCCTGAACAGAAATGTCACCGCTTGTCATGTTTAATCACCTGCTGTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286700..148286763 64
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es