Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14700G11
Clone ID IST14700G11
Vector VICTR76
Project tigm

Sequence tag IST14700G11BBF1
Sequence
ATGTCTGTGAGGAAAAGAAGCCGGAGCTGAGCAATTCCAGTCAGCAGCCCTCCGTCATCCAGCAGCGGCCCAACATGTAC
ATGCAGTCCCTGTACTACAACCAGTATGCCTACGTGCCTCCTTATGGCTACAGTGACCAGAGTTACCACAGCCACCTCCT
GAGTACCAACACCGCTTATCGGCAGCAGTATGAAGAACAGCAGAAGCGGCAGAGCCTGGAGCAGCAGCAGCAGCAGCAGC
GGGGACTGGACAAGAAGACAGAGATGGGCCTGAAAGAGCGGGAGGCATCGCTCAAGGAAGAGTGGAAGCAAAAGCCCTCA
ATTCCACCAACTCTCACCAAGGCTCCCAGCCTGACAGACCTGGTGAAGTCAGGGCCCGGCAAGGCCNAGGAGCCTGGGAC
AGATCCTGCCAAGTCTGTCATCATTCCCAAGTTAGATGACTCATCAAAACTCCCCAGCCAGCCNNNTGAANGNCTTAANN
GGAANCTGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI32002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65550174..65550665 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]


Sequence tag IST14700G11HMF1
Sequence
ATGTCTGTGAGGAAAAGAAGCCGGAGCTGAGCAATTCCAGTCAGCAGCCCTCCGTCATCCAGCAGCGGCCCAACATGTAC
ATGCAGTCCCTGTACTACAACCAGTATGCCTACGTGCCTCCTTATGGCTACAGTGACCAGAGTTACCACAGCCACCTCCT
GAGTACCAACACCGCTTATCGGCAGCAGTATGAAGAACAGCAGAAGCGGCAGAGCCTGGAGCAGCAGCAGCAGCAGCAGC
GGGGACTGGACAAGAAGACAGAGATGGGCCTGAAAGAGCGGGAGGCATCGCTCAAGGAAGAGTGGAAGCAAAAGCCCTCA
ATTCCACCAACTCTCACCAAGGCTCCCAGCCTGACAGACCTGGTGAAGTCNGGGCCCGGCAAGGCCAAGGAGCCTGGGAC
AGATCCTGCCAAGTCTGTCATCATTCCCAAGTTAGATGACTCATCAAAACTCCCCAGCCAGCCCCCTGAANGNNNTANNG
GAAGCTGGGNGNNNCAGCCNCCTANGNANGAGGCGTCNGNNGCTNANANGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14700G11HMR1
Sequence
CATCATTCTTTACTTTCCCTTCTACGCTCTCAGGCTCCTCATCCTTTTTTGTCTTTAGGGGCTGGCCCTCCATTCCTGCC
TGGCTGCTTGAGGTGAGAGTCCCTGGGCTGGACTGTGCATAACCTGGAGAGTAGTAACTTTCAAAGCCTTGATAATATGG
GGAGTCTTTGCTCTGTGGCTGAGGGGGGAACAGTGTTTTCTTANCCCCTTCTTTAACCNGCTGCTCGGGGTCCTTCGACT
TGGCACTGTCCACCTTGCCCTCCCCATCCTCCCCANCATCNNANATGTCNNNNTANGCAGGGCTATTGGTTTTGACTGAN
CTGGCTTCNGCTCCATTCTGGGTCACTACGTGGANGGGAGTTNNGGGTTGGGTCGNNNTNNTNCTATCTNNGCNGCNGCN
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es