Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12590D1
Clone ID IST12590D1
Vector VICTR76
Project tigm

Sequence tag IST12590D1HMF1
Sequence
NNCACNCGCGCNCACNCNCNNACNTGCACATACACACATTCACATAACACGCACGCACACATACATACATACATACATTC
ACAGGCGCCCCAGGAACCACACGCCAGCATCCCGTGCAATATTCCAGGCAGACACAGGCGCTCACGAGTTTCTCCGTGCC
AGCTTGCAGGACAGCGACTCCCGAAACCAATCCTGCCCTTGGCAAGCTGTTTCTGTTCTCCAGACAGCTCCTCTGCGGCC
TCCCGCACCATCTGCTGGATCCGACCCTTTTTCGACCTAGGAACCTGGAAGCTGTAAGAGGTGCTAGCTCAAGAAGCACC
AGANGTAATTAATGTCTCTTACTGGTGCTGGAGCACCGCCGGGGGTAGGGTGGGGCTCTCCATTCAGCCNCCCTGGANGA
GTCGGGCNCCNANAAANATGCTTGGATGGAGCTCCAGACTCN
Sequence Type genomic DNA
Unitrap ID UNI32003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 102830466..102830904 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019894 (Slc6a15) NM_175328 solute carrier family 6 (neurotransmitter transporter), member 15 Gene [Source:MGI Symbol;Acc:MGI:2143484]


Sequence tag IST12590D1BBF1
Sequence
ACACACGCACGCACACACACAGACATGCACATACACACATTCACATAACACGCACGCACACATACATACATACATACATT
CACAGGCGCCCCAGGNNNNACACGCCAGCATCCCGTGCAATATTCCANGNNNACACAGGCGCTCACGAGTTTCTCCGTGC
CAGCTTGCANGACAGCGACTCCCGAAACCAATCCTGCCCTTGGCAAGCTGTTTCTGTTCTCCAGACAGCTCCTCTGCGGC
CTCCCGCACCATCTGCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 102830463..102830724 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019894 (Slc6a15) NM_175328 solute carrier family 6 (neurotransmitter transporter), member 15 Gene [Source:MGI Symbol;Acc:MGI:2143484]

 
Come back to gene ENSMUSG00000019894


For any suggestions or comments, please send an email to unitrap@crg.es