Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11589E11
Clone ID IST11589E11
Vector VICTR76
Project tigm

Sequence tag IST11589E11HMF1
Sequence
ATAATAACATTTGTGTGAGGAAATATATACTTTGTGAAGTTTCTGGGTATCANTTAGGCCCAGGATCTCCAGAGTGATTC
ATCTGTGTAGTAGCTCTTCAGTATGGTCCTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI32004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84325489..84325604 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]


Sequence tag IST11589E11BBF1
Sequence
NAATAACATTTGTGTGAGGAAATATATACTTTGTGAAGTTTCTGGGTATNANTTANGCCCAGGATCTCCAGAGTGATTCA
TCTGTGTAGTAGCTCTTCANTATGGTCCTGTCAACTTCATGCCATAGGCACACAGGTTATTAAACACANAACTCCTTCCT
ACCNNATCACATGANGAAGCANACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11589E11HMR1
Sequence
ATAAGGAANAGATAATAGGAGTCATAAGATGTATGTGTTTGTGTGTGTGTGTGCCTTTTAAAACCAAAACTTACCCAGCA
AACCATTGTTAGTGANCTGAAATTTACAANCTGAAACAATGCTAATTGTGAAACCATGTCTATGANTATTTATTTTACTC
ATACNTTTTTAANATGTCCTTAAATANNTTTTTTCTTGTAAACATTGAAAACATCACGGGCATCATCCTTGGTTGCTAAG
GCTGGTTGCTAAGGCTTGTGAACTTCCAANTAAACNNANTTATATCCNGGTGGAGGTAACTCCNCCCCCTGGCNNNCNTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020037


For any suggestions or comments, please send an email to unitrap@crg.es