Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111H12
Clone ID IST10111H12
Vector VICTR76
Project tigm

Sequence tag IST10111H12BBR1
Sequence
CAGGTACTCCCAACCAAAATAACTTTACCAAGTCTTCCCTGCTACTCTGCTAAGGGTGTTACATATGAATGGATTCTGCT
CTATTCTCTCCTACATTCTCAGTATCAATCTCTGGCACCAAGCAAGAGGTCATTTGTGAAGAAACGCTTCCTCAACTGTC
CACAACCTGAAACTCGATTTCTAGTATTTGTCTCTAGGGCAGAAATACGTAACACGGGAAATACATGTCCTTGACTTCAG
TACGAAGTTATCTGTATTAAGCAAATGTTTAATGAGCTCCTAACTAGTACATGACTCTCTAGACACCGAAAAGACTAACA
AATTCCTTGCTCCTGAGAATTTACAGTGTGTTGAGAGAAACAAACAAACAAACAAACAAACAAGCTGTCTGATAATGCTA
ATGGACACTCAGAAAAAACAGTAAAATGAGTGGTTGGGTTCGGAGTGTCTACGCTGCAGTGTCAGAAAACTACTTTGTCT
AAAGGTATGGTATGTCTCCAGAACTTCCTTATATCCAAATCGCTACTTATTTTCATCATGAACTGGACAGGATCAAGCCC
CAAGAGGGCACGATGAACCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722716..69723296 579
 
EST/CDNA Est Name
  AK013063.1


Sequence tag IST10111H12HMF1
Sequence
CTGCAAGAGGGAATCTCTTTCAGTTCCAAAATGGCTGTGTGTAAGCTGCCAATGTAATCTCCATGGGTTTTCATTCTAAA
ATAGTGTCATATCACCAATCAGATTTGCAATGAACTGTGTTCAGATTAAGACTAGTCTGCTATGTATTTAGCGTGTGTAT
GTTCGTGTGTCTTGTGTGTATGGAGGGTAA
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722530..69722718 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]


Sequence tag IST10111H12BBF1
Sequence
CTGCAAGAGGGAATCTCTTTCAGTTCCAAAATGGCTGTGTGTAAGCTGCCAATGTAATCTCCATGGGTTTTCATTCTAAA
ATAGTGTCATATCACCAATCAGATTTGCAATGAACTGTGTTCAGATTAAGACTAGTCTGCTATGTATTTAGCGTGTGTAT
GTTCGTGTGTCTTGTGTGTATGGAGGGTAGAGGTCAACATAGGGTGTTTTTCTCAGTTGCTCTCCATACGTTTGAGCCAG
GGTCTTACTGTATTTAGAGCTTACCCATTCACCTAAACTGGCTGACCAGCAAGCCTCAGAGATCCTTCTGTCCTGTGTTC
CTAGCACTGGGTTTATAATCATGAACACCTGACCTTTTACATGGCTGCTGGGTATATGAGCTCAGGTTCTAATGCTTTCT
GGGTAAGTACAGTACACACTGAGCCAGCTACTACCACACAAGTCCCTGGTTTTCTCATTGTGACTTTTTACAGCTTCTGG
TTGTAAGGTTTGTAATGAAACCTAATTTTCTTTTAAAGATTTATTTTATTTATTGTATGTAAC
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722178..69722718 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es