Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11081H6
Clone ID IST11081H6
Vector VICTR76
Project tigm

Sequence tag IST11081H6BBF1
Sequence
CCCGCCTGGGACTTAGACATAAGTGGCTAGAGCAGGAGTGTGCGTAGGCAGCAATGGTCTCCCAGAATCGGTTCAGTAGT
AGAGATCCGCTGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI13079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24770345..24770441 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041429 (Nthl1) NM_008743 nth (endonuclease III)-like 1 (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1313275]


Sequence tag IST11081H6HMF1
Sequence
CCCGCCTGGGACTTANACATAAGTGGCTANAGCAGGAGTGTGCGTAGGCAGCAATGGTCTCCCAAAATCGGTTCAGTANT
ANAGATCCGCTGGGATCCAGGCTGAGGCTTGGCAAGGGCCAAGGGCCACAGAAAGTGTTGATACTGTTAAGGCAGCAAAT
GTTTTATAGTAGTAGAGTTTGGAGCTCATCCTAAATGCAACGATTTCTGAAAGGGGAGTTGCACTGTCCAGTTTGGGTGT
GAAGAGAGAGGTTCTCTTGAATGTAACTCAAAGGACTTGGGACAAAGGAGAGAGGTTATATTATCCTAGAGGCTGTTACT
AGTGTCGGTGTGCTAACAGGCACTTTGTCNGACTGTCATGTACTGTTGTGACAAGGGCAGANCACAGCACTTCTGTACAC
ATCGTGGTAGATAATGGACAGTTAGTTGCACANACAAGTGTGGGGATGTGGATTGGCNNGTAANCANCACCCTTCCCCCA
CCCTCATATAAAACCCACTCCAAAGNNTGAATGGNACTTTTTTGCAGANNNNAGAAAAAGCCNCNNNCCCNNGANACATC
CACGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041429


For any suggestions or comments, please send an email to unitrap@crg.es