Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13010D6
Clone ID IST13010D6
Vector VICTR76
Project tigm

Sequence tag IST13010D6HMF1
Sequence
AAACCAGATGAAATTAGCCAAGGCCGCAGCAACCACTCGGACTATTTTTGTGGGGTTTCTCAGCTAGTTTCTTAGGCTTT
CTGCCGCCCCCACAACAATCTTTCCTAAAGTGAGGCCTTTGCACCGGGATGCTGTTAAAACTTAACAATTTGCATACGGG
GGTGGGGGTGGGANAAAAACAACCTGGGGAAAGANAGGTGTTTTTTGGTTTTTGTTTTTTAAATTTATACTGGTTGTTTG
TATTTTCCACNCAAAGAATTTCNNANCTAACAACCACCACCTCGAGCTTGGGAAGAAAAGACNCTTGCTAGTTCTTCNCT
TTGANTCNAGAGCNNGN
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91564363..91564695 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST13010D6HMR1
Sequence
TTTACCCTCAAACCGGTTCTTTTGGGGTGGGAAACTGGGTGTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91564694..91564738 45
NO GENE  

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es