Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14382B4
Clone ID IST14382B4
Vector VICTR74
Project tigm

Sequence tag IST14382B4HMR1
Sequence
GGTACGTCTAGGGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAAGAAAAAGTTAAGGCAAAGATGGGTTGAGG
TGGCGTAGAGCAGAGCTTGTGTTGGTTAGGGAACGAAATCAGGGAGACAAGGGAGGAAACACTCATGGCTAGAAACTGGC
GTTGTGTGTGAGGTTGANAGAGCATTACTGAGCGCTGCCTAGAAACCNNNNTGACCTTGAGGAAGAAACCNTGTGAGTCA
NGGCAGGGTCATGACTTGGATGGGTTGANATAATTGTTTCTCTGANANTTN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857375..97857665 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14382B4BBF1
Sequence
NTACCCAAACACTCACCTTCCTCTGANANCCNAGAAGTTGAGTGTGCCAATAATGAAATAACTGAAAAGCTACTACTACC
CAAAACTACGTGGTCCTCGGCAGTGCTCAGCAAGCCCTTTCTAGTCCCTGTAAAAGATTTGCTTACAGTTGGGTAAGGCC
CACCTCTGANTTTGTAGGTGGATGGTTAAGGGTTTATTTTTAANNATTNATTTANTTNNNTTNNGAGTNCACNGNANCNG
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14382B4HMF2
Sequence
TCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCCTCCTTATTCATANAGAAATTCAAGTATCTANAGTGGAGTC
NAATTTGGTACNNNAAAAANAATTANTTTTATTATTTTTATTAAATCAAATTAAACTTATTTTTTAATTAANTANTTTGA
GACAAAGGCNCACTGTGTANCTCTGGCCNNCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es