Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13056E10
Clone ID IST13056E10
Vector VICTR76
Project tigm

Sequence tag IST13056E10HMR1
Sequence
CCCAAAGAATTAGTTATGCAAAACACTCATATATAAATCTTTAAAAAACTTTTTANAGTAGTTATCTTTGTTTAGAAGCC
ATCCAGTGAATTCCAG
Sequence Type genomic DNA
Unitrap ID UNI32011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35507827..35507922 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


Sequence tag IST13056E10BBF1
Sequence
GGGGCAGCCTCTGCTACATGTAAATTTGTCTCANAAGAAAAAAGGAAACGGGCAGTAGTGGCGAATGCCTATAATCCCAG
CACTTGGGAAGCAGAGGGCAGGCTGATTTCTGAGCTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGG
CTACACAGAGAAACCCTGTCTNAGAAAGAAAAAAAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35638650..35638849 196
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es