Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14431D1
Clone ID IST14431D1
Vector VICTR74
Project tigm

Sequence tag IST14431D1HMF1
Sequence
GGTAGTGGGAGGAGCACTGGCCTCACAAGTTTGTGTAATGAATTGATCTGTCTTTTTCTAGTGACCAACGATATCACTAA
TTCTTGTGGGTTTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172806..27172904 99
NO GENE  


Sequence tag IST14431D1HMR1
Sequence
CNNNNNNNANNNNNNNANAGNANGANAANNNNNNTNGANTGNNNNTGGTTGGGANAAGTTGAAACCATTATGCATTACAG
GCAGGATGGGGCAATGTTATAGAAATAAGTTTGAAATGTTTTAAACATAAAGTTTACATGTGATTCACTAGTTCCTCTTC
TAAGTACATTAATAAAAGGACTGAAAGTGGATACAATCAGATAATTGTGCACATATATATGCACATAGCATTATTCACAA
TTACTACTAANTANAAATAATGCGCATCCACCAACAGATTAAGTACAATAAATGCATACNTTGGAATATTATCAGTAAAG
AGAAGAAAGTTCTGCANAAGTGCTGTAATATGGGCAAATCATCAACGTAACTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172433..27172764 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es