Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12773H10
Clone ID IST12773H10
Vector VICTR76
Project tigm

Sequence tag IST12773H10BBF1
Sequence
ATTCTCTCTATTTATTTATTTATTTATTTACTCTTTTTTCGGTTTATTTATTTATTTATTTACTCTTTTTTCTTTTATTT
ATTTATTTATTTATTTATTTTGAGACAGGATCTCACTATGTTGCCCTGGTTGGCCTGGAACTTGCTATGCANACCAGGCT
GGCTCCAAACTCTCAAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32012

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116519979..116520161 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]

 
Come back to gene ENSMUSG00000075410


For any suggestions or comments, please send an email to unitrap@crg.es