Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14619B8
Clone ID IST14619B8
Vector VICTR74
Project tigm

Sequence tag IST14619B8HMF1
Sequence
NANNNNNNNCNNGNNNNCCNNCCNNNNNNNNANGANNNNNNTTTACANNNGANANGANNANNAATACNANCTCATTANGG
AACNTANNCCTCCNCTTCNCATTAANTTAAANACNCTGANAANCNNNTATCCTCTTGGGCAAATGGTGCCATGTNNTGNN
NNTATTANNCACATNACANCTATNAAATANNACCTANNCNAANNGANACTTTGGTTTCANTTNCTTANGACCNNCCACAT
CNTTTGTTTCTGCTCATGGNATTGCNACTNNCANANTTCNTCCTGCTNACATTANCAATANATNNANNNNNAGATNNATA
NATNNAGGGGACTGGACACATGNCTNANTGCTTANCAGCACTGCTGCTTTTCANGANGATCCNANTTCAATTCTCANCNC
CCACATGGCAGGTCACTGTCTGATTCCANTTCTAANGGACCCNTACACNNANNNNNTGCNNNTGAAAAGGCTCNNGACTT
TTANNTCNCTTCTTCTGTATGTTTGCTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14619B8HMR1
Sequence
GTTTCTTTACTGTACTTCNNTCAGAAGAGTGAGAGATGGAACCTGAAGAAGAAAGGATTCGGTACAGCCAGAGATTGGTT
AGTATTTTCAATTCCCTCCTTTTGGAAAAAATTATTTTAGATGGCTTTTCTGTGTACCAGAGGAGGGGTGAAAATATNTT
GATATCTCACTTGGTTTTTTTTTTGGTTTTGTTTTTGGGGGTGTTTTTTTTTTTTTTNNTN
Sequence Type genomic DNA
Unitrap ID UNI9872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4394652..4394868 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]


Sequence tag IST14619B8BBF1
Sequence
AAACCACTCCAGGGATGCCTTCCTCTTCCTAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4394865..4394901 37
NO GENE  

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es