Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10730B10
Clone ID IST10730B10
Vector VICTR76
Project tigm

Sequence tag IST10730B10HMF1
Sequence
GTTAGGACATGACAAAATTAGGACATGACAGGCTCAGAGCAGACCAGGCCANCCTGGGCTAGAGAGAGACCATTTTCACA
TAAAGTCCCCCAAACAGGAGGGACAGCTCTGAAGCCTAGGCTGGCACTCTTCCTGCCCCCACCTTCCTTCCAAGCTATAC
TTTTTAGAAGTCCACTAAAGATACTTGAGCAGGAACCCAGTGTGAGGGCAGCAGGCCCAGGCTATCGCAAGCAGGTGTGG
GGCTCACTGCTGCCTTTGCTCACAGTCATTTCCCTGCTCCAGCTGTGGANCCTACAACTTAAGCCCACCTCTGAGAGGGT
CTGTCCTTCCCCANAGCTCACCTAGCCGGGACTGTAATGTGCNNTCGTCGGTTAACGCCNTC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56848720..56849098 367
 
EST/CDNA Est Name
  BU755843.1 - AI643456.1


Sequence tag IST10730B10HMR1
Sequence
TAACATTTGGTTACATTCCCCTTAAAAGTTAAGGCCNGAAATTGGGAAGCTTANGCAGGAGGACTGAAAAGAGTTTGAGG
TCANCTCANGCTACTGAGACCCTCACATCANGAAAGAAAAGTAAAAAAAAGAAAGGTTAAAGTCAATGTCC
Sequence Type genomic DNA
Unitrap ID UNI17634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56849095..56849244 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es