Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13797H12
Clone ID IST13797H12
Vector VICTR74
Project tigm

Sequence tag IST13797H12BBF1
Sequence
AATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI32013 UNI32014 UNI32015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45744742..45744791 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 32294035..32294084 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024386 (Proc) NP_001036232 protein C Gene [Source:MGI Symbol;Acc:MGI:97771]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88573425..88573474 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072919 (4933437F05Rik) NM_027744 RIKEN cDNA 4933437F05 gene Gene [Source:MGI Symbol;Acc:MGI:1918525]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96963633..96963682 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75615423..75615472 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 51452118..51452167 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006281 (Tep1) NM_009351 telomerase associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:109573]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113830925..113830974 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88416523..88416572 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137672988..137673037 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120839991..120840040 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 47356031..47356080 50
NO GENE  

 
Come back to gene ENSMUSG00000006281


For any suggestions or comments, please send an email to unitrap@crg.es