Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0271
Clone ID CC0271
Vector pGT0lxfT2
Project sanger

Sequence tag CC0271
Sequence
CCCTTCCTCTCTTAATCACTTATTCGCCTACCTGCTATTCTATCCTTTCATCAACGAACTTATTATTTCCATGGTCTCCG
CCGCCATGAGCGGCTCGTCCGGCACCCCGTATCTGGGCAGCAAGATCAGCCTCATCTCCAAGGCGCAGATCCGCTATGAG
GGCATCCTCTACACCATCGACACCGACAACTCCACCGTGGCGCTCGCCAAAGTGAGGTCCTTTGGTACTGAAGACCGTCC
CACAGACAGGCCTGCTCCCCCAAGAGAGGTTTTCCACGAGGTAATAATTTCACTTTTTTTTTTTTTTTTCGAGACAGGGT
TTCTCTGTGCAGCCCTGACTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTAAACTCAGAAATCTGCCTTGCTTCC
CAAATGCTGGGATTAAAGGACGTGCGCCACCACACCCGGCTGACACACATCTTTAATCCCAGTACTCCGAGGGCAGAGGA
AGTCT
Sequence Type mRNA
Unitrap ID UNI1539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179759883..179761417 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039108 (Lsm14b) NP_808395 LSM14 homolog B (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14b-002]

 
Come back to gene ENSMUSG00000039108


For any suggestions or comments, please send an email to unitrap@crg.es