Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M124F11
Clone ID M124F11
Vector ROSAbetageo0
Project ggtc

Sequence tag M124F11
Sequence
CGGCGGCGGCGGCGGCGGCAGCGGATTTGGCGGCGGCTTTGGCTCTGAGGGACAGGGGTAGTGTTCCTGGTTTTGGTGGG
GTTTGCCTTTAGTTTAATTTTCCTTTTCTAGCTTCCCTTTGCCGGCTGGTGCGTACGTTGTAGTCCCCCGAGGCCATGTC
AGGAGACGCAGCCGCGGAGCAG
Sequence Type mRNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104430678..104430859 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es