Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14555D9
Clone ID IST14555D9
Vector VICTR74
Project tigm

Sequence tag IST14555D9HMR1
Sequence
TTATTTAATGGCTTTGTGTCTCCTGTAAATTGAGTGGAATGCTAACACCAATGGTATCAGTGTTTTGTTTTAC
Sequence Type genomic DNA
Unitrap ID UNI29946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33007741..33007812 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14555D9HMF2
Sequence
AATATGCCCAATTAGTAAGTGACAGAGCTGGTGATATGAGGATGGGANCCTGANNATAAAGCTGCCNNNNNNNNNCAATA
GAGTCCAGGCCCTCAGGGAGACTGCAGCCACAATAAATCCACCCCTTCCCTTCTCCAACGTGAGGCCNTGAAGGGAACTG
CCGTGGCCCCGAGTGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14555D9BBF3
Sequence
ATCCGTTTGGGGACAAGAGCTATGGAACTGGATTCTGACACTCTCACAATGCCTGGGAATCTGTGTATGCGTGCATTTGC
CCAAACCGGGTTCTGCAAACCATGCTAAATAAACATCCAAGAAACAGACCAGGGCTGGGAAGACCTGTGGGTAAGGGCAC
CTGCCATCAAGCCTGACTTCCTGAGGAACACATGTGGTCCCTGGGACCTGCATGGTGGAAGGAAAAGAACCAAGTCCTGA
AAGCTGCCCTCTGACCTCCACACACATGCCTCAGCGTGTGTACACACAGAAGAAACACATCGAGATATAATTTTAATTTT
TTTTTTAAAAAANAAATAGGCTATGTATGAACTCACATTCACCTATAACCTAAATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 133998336..133998713 374
 
EST/CDNA Est Name
  BB849858.1

 
Come back to gene BB849858.1


For any suggestions or comments, please send an email to unitrap@crg.es