Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579B9
Clone ID IST14579B9
Vector VICTR74
Project tigm

Sequence tag IST14579B9BBF2
Sequence
GTGAGATGGCTCAGTGGGTAAGAGCACCTGACTGCTCTCCGAAGGTCTGAAGTTCAAATCCCAGCAACCACATGGTGGCT
CACAACCATGTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1859 UNI31247 UNI32020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514427..98514530 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017211 (Gsdma2) NM_029727 gasdermin A2 Gene [Source:MGI (curated);Acc:Gsdma2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135843494..135843597 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048170 (1110007A13Rik) NM_145955 RIKEN cDNA 1110007A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920977]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134854743..134854846 102
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121262299..121262402 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027248 (Pdia3) NM_007952 protein disulfide isomerase associated 3 Gene [Source:MGI (curated);Acc:Pdia3-001]


Sequence tag IST14579B9HMR1
Sequence
CTCACCAGCCCGTATGCATGCATTATTATGCATGAAACTACACTGCAGCTGTCTTCAGACACACACCAGAAGAATACATG
GGATCCCACGGCAGATGGTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027248


For any suggestions or comments, please send an email to unitrap@crg.es