Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10211F12
Clone ID IST10211F12
Vector VICTR76
Project tigm

Sequence tag IST10211F12HMF1
Sequence
CAGGGTCTGCAGGAATCCTCANCANGGTGGACACCAACTGACCCCATCTGCCACCTCTGTCTACAGGTGCCGGCTCTACT
GTGACCNCGCCCATTACCCTCAGCCTCTTGCTCCTCCTTANCCAGGCCACCTCAGACCCATGCTATGATCCAGGAGGGCG
CCCTCGCTTTTGCCTCCCACCAGTGACCCAGTTGGTTGGCAAGGCAGCAGCCCCCTGCTCTCANACCTGTGCTCTTCCTG
CANCCNNCCCTGGCCCTGCCTGCAACAGTAGTCTGACCCTGGACCTGGACGGCTCCTTCCTCTTGACATCTGTGACCCTG
CGTTTCTGCACAGCGGGACCTCCAGCCCTGGTTCTTTCTGCTGCCTGGGCCACTGGGGGGCCNTGGANGCN
Sequence Type genomic DNA
Unitrap ID UNI32021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52941485..52941874 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070564 (Gm484) NM_001033356 gene model 484, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685330]

 
Come back to gene ENSMUSG00000070564


For any suggestions or comments, please send an email to unitrap@crg.es