Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15072C6
Clone ID IST15072C6
Vector VICTR80
Project tigm

Sequence tag IST15072C6HMR1
Sequence
GCTGCCGTGTGGGTGCTGGGAATTGAACCCAGGTCCTCTGGAAGAGAGCAGCTAGTGCTCTTAACCACTGAGCCATCTCT
CCAGCTCTCTGAGTATACACGTTTTTGAACACAGGGACATGTGCATCACTAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93242867..93243001 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es