Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120H03
Clone ID M120H03
Vector ROSAbetageo0
Project ggtc

Sequence tag M120H03
Sequence
TATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGGAG
Sequence Type mRNA
Unitrap ID UNI5036 UNI5037 UNI5038 UNI5039 UNI10782

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9564618..9564662 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081441 (AC103620.12)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59269263..59269307 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020111 (Cbara1) NM_144822 calcium binding atopy-related autoantigen 1 Gene [Source:MGI Symbol;Acc:MGI:2384909]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8784187..8784231 45
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41753588..41753632 45
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94464949..94464993 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041929 (CT573086.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75497336..75497380 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285349..54285393 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12159941..12159985 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060989 (AL805912.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66639845..66639889 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 72929705..72929749 45
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538903..114538947 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702039..77702083 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  

 
Come back to gene ENSMUSG00000067669


For any suggestions or comments, please send an email to unitrap@crg.es