Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0138
Clone ID GC0138
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0138
Sequence
TGCTCCGCGGNAGGAACCTGCCATCACTGGGAATCAAGACCCGCGGCCGCCGCCACAGACGCCTTCCAGAATCT
Sequence Type mRNA
Unitrap ID UNI154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150785889..150785961 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es