Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11089F6
Clone ID IST11089F6
Vector VICTR76
Project tigm

Sequence tag IST11089F6HMF1
Sequence
TTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTTGTTACGGATGGTTGTGAGC
CAACG
Sequence Type genomic DNA
Unitrap ID UNI14180 UNI32028 UNI32029 UNI32030 UNI32031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317930..318011 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5979562..5979643 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 80461356..80461437 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034006 (Pqlc1) NM_025861 PQ loop repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914193]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17209089..17209170 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20832177..20832258 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34209108..34209189 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022257 (Laptm4b) NM_033521 lysosomal-associated protein transmembrane 4B Gene [Source:MGI Symbol;Acc:MGI:1890494]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9798083..9798164 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3961176..3961257 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 43031576..43031657 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055415 (Atp10b) NM_176999 ATPase, class V, type 10B Gene [Source:MGI (curated);Acc:Atp10b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30860266..30860347 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 73455572..73455653 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 21338033..21338114 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050844 (1700020N01Rik) RIKEN cDNA 1700020N01 gene Gene [Source:MGI Symbol;Acc:MGI:1914942]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34395909..34395990 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37367245..37367326 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19752054..19752135 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3317593..3317674 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34883081..34883162 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 34784544..34784625 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 58945280..58945361 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25186138..25186219 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17778429..17778510 82
NO GENE  


Sequence tag IST11089F6BBF2
Sequence
TTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 108385598..108385658 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 71619913..71619973 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160211003..160211063 61
NO GENE  

 
Come back to gene ENSMUSG00000050844


For any suggestions or comments, please send an email to unitrap@crg.es