Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14998H11
Clone ID IST14998H11
Vector VICTR78
Project tigm

Sequence tag IST14998H11HMF1
Sequence
CTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI29742 UNI30913 UNI31444 UNI31537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 19471155..19471250 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 21576279..21576374 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 18610330..18610425 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 13368347..13368442 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020576 (CT025539.18) 4933425L03Rik protein [Source:UniProtKB/TrEMBL;Acc:Q6PGH6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23509288..23509383 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62400282..62400377 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 6773433..6773528 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27677769..27677864 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 42509208..42509303 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10824230..10824325 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067577 (A430093F15Rik) RIKEN cDNA A430093F15 gene Gene [Source:MGI Symbol;Acc:MGI:2685520]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5618734..5618829 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 112448345..112448440 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32131988..32132083 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23267178..23267273 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 46657256..46657351 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26738304..26738399 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 30932883..30932978 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48265455..48265550 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161868: 434533..434628 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161892: 385418..385513 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161923: 820731..820826 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165791: 228128..228223 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165792: 442105..442200 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 121274..121369 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166351: 96460..96555 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166354: 30567..30662 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166365: 22609..22704 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166372: 97114..97209 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166380: 168283..168378 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 56080..56175 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166414: 21752..21847 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166419: 575012..575107 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 13240321..13240416 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047678 (Gpr82) NM_175669 G protein-coupled receptor 82 Gene [Source:MGI (curated);Acc:Gpr82-001]


Sequence tag IST14998H11HMR1
Sequence
GAAGGAAGGAAGGATTTTCAGACATATGATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGAT
TTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006312..3006379 66
NO GENE  

 
Come back to gene ENSMUSG00000047678


For any suggestions or comments, please send an email to unitrap@crg.es