Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10533G10
Clone ID IST10533G10
Vector VICTR76
Project tigm

Sequence tag IST10533G10HMF1
Sequence
AGAGAAGGAATCAGAGCTCTGGAAGCTTCAGGGGCCAGAGGAGCAGGCAGCAGCAAGAGAGGAGGCGCAGGCAGGGGTGA
GACCAGGCCTCTCCGCTGGCCCCGACGAGCCTGGACTCGGGCCCTGGGATGGGTAGGGTCTACGAGGTGGCTTCTGTCTG
TCTTGGGGTGAAAGGAGCATGGAGGGCAGAGGCAAGCCCTCACTCCTGAGTCTGCCCTTCCTCCTNATNAGGAACAGGAC
CTGAACCACGAGGCCGCAGCAGATCCAGCTCCAAGCCCTCCCAATGGTCAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI32033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126536449..126536744 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040462 (Os9) NM_177614 amplified in osteosarcoma Gene [Source:MGI Symbol;Acc:MGI:1924301]

 
Come back to gene ENSMUSG00000040462


For any suggestions or comments, please send an email to unitrap@crg.es