Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518H2
Clone ID IST14518H2
Vector VICTR74
Project tigm

Sequence tag IST14518H2HMR1
Sequence
GGTATCCTTGGGGCAAGTTGGCCCGCACTTCCTCCAACTCTGCTTCGCTGCCTCTTGGAGGAATTTCCGCGGTAGCTTCC
GGCGCGTGCGCTGCGGTAACGAGCATATGCATATTCCACAGCAAAAAGACTCAAGTTTAAGTTTTTGGTCCAAAAGTTAA
ATGCTTTTAAGTTACTGCCGCCTTCCTGTCATAGTAGTTGCTTCCTCTCGGTGACTAATCTCCGCTTACTACACACCAGG
GGCTCCTTTAAGCTCCTGACGTGTCTTAACTCATTCACAATANTACGTGATGTAGGTGCAACAGGCTGACTGTGCATTAN
CAAGAAACGCCTGGGTTTTGAAGTGGTTCGGTTTGN
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150734062..150734416 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]


Sequence tag IST14518H2HMF1
Sequence
TACCCTCGGAAGAAGGGGTACTGCTGACGACCCTGAACCCGTTAGGGGCGCCCGGGTCTGAAGGCTCAGTGTGTGTCACT
AGGCTGGCTCCGCCTCCACCGCAGGCTCAGAGAGTGAGGTCTGGCTCAGAGACCGGGGCACTGTGCGGAGAGCATGCAAA
GCCCGGAAGGGCGAGGCGGCGGCCCAGTAGACCCCTTCCTTCCCAGGCGCGGTCTGAGACGAGGCGTACCCAGGCCCACC
TCGCTGGGGAGGCCTTGTCCTCTCAAGGAACCGCCTGCGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150734413..150734693 281
 
EST/CDNA Est Name
  BY321309.1 - BY327870.1 - BY270422.1 - CX230145.1 - BY264490.1 - BY217663.1 - BY055197.1 - BY233978.1 - CJ179293.1 - BY277856.1 - BY770881.1 - BY296422.1 - BY299622.1 - BY070558.1 - BY233417.1 - BY323847.1 - BY321249.1 - CA563837.1 - BY325093.1 - BY073069

 
Come back to gene BY321309.1 - BY327870.1 - BY270422.1 - CX230145.1 - BY264490.1 - BY217663.1 - BY055197.1 - BY233978.1 - CJ179293.1 - BY277856.1 - BY770881.1 - BY296422.1 - BY299622.1 - BY070558.1 - BY233417.1 - BY323847.1 - BY321249.1 - CA563837.1 - BY325093.1 - BY073069


For any suggestions or comments, please send an email to unitrap@crg.es