Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120A07
Clone ID M120A07
Vector ROSAbetageo0
Project ggtc

Sequence tag M120A07
Sequence
GAGCTCTACCCTCTCGGGCGGGAGCCCGTGCGCGGCCTGGAGATGGCAGGGGATAGCAGGAGACTCTCCCTCCCCCAGCC
CGGGTGCGAGACGTGCGGCCTGGAGAAGAGGAAGGAAGACGAGGAGGAACTCGCACCCCGGGTTTCG
Sequence Type mRNA
Unitrap ID UNI11455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114690453..114690599 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052724 (AC163344.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C9E7]

 
Come back to gene ENSMUSG00000052724


For any suggestions or comments, please send an email to unitrap@crg.es