Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14811D11
Clone ID IST14811D11
Vector VICTR76
Project tigm

Sequence tag IST14811D11HMF1
Sequence
CCCTGACGCCTGGGCACATTTTACTACNAGCAACGGATGTCANCGCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14811D11HMR1
Sequence
AGGGTATCATTCCATTACCTGAGCCCTGCCTTTCTCGTGGCGTTAACTGACTGATAGTGGGCAGCCATCCCAGTGGTGCA
CGTCTCCAACGTTTTTTCGCAGCCTATAAAAGGGAAGGGTTTTCTGCTCTCTGGGTCTCCTCTCCTGAAGCCGATCATCT
ATCTCTCGAGATGTATTAAAGCTGTACTGCAGAAGGATCCNAGTGGCCTGCGTGTGTTTTGCTGGCGAGACGGTAGCGTG
GGTCC
Sequence Type genomic DNA
Unitrap ID UNI24379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130326466..130326710 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025538 (Sumf2) NM_026445 sulfatase modifying factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915152]


Sequence tag IST14811D11BBF1
Sequence
CCCTGACGCCTGGGCACATTTTACTACGAGCAACGGATGTCAGCGCCATCTTGTAACGGCGACTGTGAGGGCGGTTCCTC
ACAGTGGGTTAGGGAAGGTGGCAGCCCACACCTTTAACCCCAGCACAGAGGAGGCAGTGGTGGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130326319..130326469 151
NO GENE  

 
Come back to gene ENSMUSG00000025538


For any suggestions or comments, please send an email to unitrap@crg.es