Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14633G9
Clone ID IST14633G9
Vector VICTR74
Project tigm

Sequence tag IST14633G9BBF3
Sequence
TTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI27725 UNI32036 UNI32037 UNI32038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36681261..36681328 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29126616..29126683 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4745420..4745487 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 81454174..81454241 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17650946..17651013 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30313396..30313463 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7994906..7994973 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17466886..17466953 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006134 (Crkl) NM_007764 v-crk sarcoma virus CT10 oncogene homolog (avian)-like Gene [Source:MGI (curated);Acc:Crkl-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12178960..12179027 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20169582..20169649 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5360638..5360705 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30025483..30025550 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10307438..10307505 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11112392..11112459 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65606689..65606756 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037890 (Wdr19) NP_700440 WD repeat domain 19 Gene [Source:MGI Symbol;Acc:MGI:2443231]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29054272..29054339 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20097572..20097639 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002043 (Trappc6a) NM_025960 trafficking protein particle complex 6A Gene [Source:MGI (curated);Acc:Trappc6a-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 8747478..8747545 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7991862..7991929 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11456103..11456170 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 575858..575925 68
NO GENE  


Sequence tag IST14633G9HMR1
Sequence
GTTCCNGGACTGCCAAGGGACAGCGTCACAACTGAAAACAGAGGGTGGGAAAAAAATCTCCAAAGTGTAAAAATGTATGA
GGGAATAACAAATTGAATCATAAACCAAGATGCATTCTCGTAAGCCTCTGCACACTTGGAGAGGGACCGGAAAGGAGGGT
TTTTTATTATTGAAAGGGAAATGTCCATAAACTGCTTGGATACAAAAATCCATTGGTTTTGTATCGGAGAGGCAAAAATT
ATCCTCAGCTCATTGAAGGAGCTGTCGTATGTTATCTAAAGCGGTTAAAATCANCCTTGTCACANAAATCTTGTGTGTAC
NTGAGGAGTGTGCAGGGTATGTATATATGAAGGAGTTTTTTGAANTCTTTNNNACNGTTCCNTNGNTNNGNNNGTNTNCA
AAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14633G9HMF2
Sequence
NAACACAGTGCTTTTAANTGANTTACNGTNCNATCCANCCTTTGCACAGCTTTGTTGANNATNNANATGTCTTTTAANCC
TNNNNNNNNCCNNACTCNTGTANCCNANNCNCANNTTCTCTTANGTATCCNANAATGANNNNGANCTTCNNAACTTTNTG
TCNCTTCCNGAGTGCCTCACCAGGCTAGGTTTATTCCGTGCTCGGGGATGGTACACAGGGCATTTGTNANANCTANGCAA
ACACTANCCACTGAACTACCTACATCCTCTGGTCCCACAACCCATAATATTACTGACCGTCTGGTGAATGACAATAGGTG
CCTCAAAGGTGAGATCACACCGTGAAGGCNGGCTGAGGAACCNATTGTTTGGGTTCACCTCTTATCNNANTCATCTGTAA
GCTTCTTTNTCTTTATCTACNCAATGNNACTGCNCTGACCTCACANGTCTGCCNTGGTTAANAGGATCTGNCTTTTNCTG
CGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002043


For any suggestions or comments, please send an email to unitrap@crg.es