Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M124H07
Clone ID M124H07
Vector ROSAbetageo0
Project ggtc

Sequence tag M124H07
Sequence
CACTTACGGCCGAAGCGGTTCGCGCTGTGAGTCGGTGGCGCCGTGCAGGGCACTTAGGAACCGACAGCCTTGGCGCGGAC
TGGTATCCGGTTGATTGCGGTTTGCAGGGTCCGCCATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAA
AACCCTCACTCTGAGTACGGGCTCACAGACAGCGTTGAGAGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATC
GAAACAGAAGGTGGATCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGAC
TTGCTGTGCTTGCCAAGGAAAG
Sequence Type mRNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74707060..74715762 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]


SPLK-Sequence tag 3SM124H07
Sequence
GAAGTCTGACGTCCCAGAAGTGCCGTGCTTCCCACAAAGCAAATGTAAAAAAAGATTGGAAAAATTGAAAGGACATTTTA
AAAAGAAGCAGTTGTCTAAATGCCTCTGACCAGTTGCCATGAGTGCATCTGTGTGCTAATGTTGCTGGTGGCATGTCCTT
TCTTTACTTGTTCTTTTGCTGGAGGACAGTACTTAGGAAACTATACACACTGTAGGCATATAGCTTGATGAGG
Sequence Type genomic DNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74699961..74700193 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es