Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M125C09
Clone ID M125C09
Vector ROSAbetageo0
Project ggtc

Sequence tag M125C09
Sequence
TCCGGAATGGAGTGTGGGGCAGTCCCACCCTCCAGGGTGGGTGTGGGGGGTCTCTTTTCTTTCTTTTCCCCTAGGAGTAG
TCCGGGCTTCCAGCATCTTTCCTATCCTGAGCGCCATCCTGCTGCTGCTCGGGGGCGTGTGCGTAGCTGCCTCCCGCGTC
TACAAGTCCAAAAGGAACATCATCCTGGGCGCAGGGATCCTGTTCGTGGCAGCAG
Sequence Type mRNA
Unitrap ID UNI11459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3412407..3412570 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053395 (Cacng8) NP_573453 calcium channel, voltage-dependent, gamma subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1932376]

 
Come back to gene ENSMUSG00000053395


For any suggestions or comments, please send an email to unitrap@crg.es