Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710H10
Clone ID IST14710H10
Vector VICTR76
Project tigm

Sequence tag IST14710H10HMF1
Sequence
AAAGTATAGGTGTGGAAAGAAACTTGTGTTTGTGTATGTATCAAGTGATAGGAGTCACACAAAAACTAATACTGCTTGCC
TGTGTTTGTGGGACTGTTCAGTGGGAAATACTTGGCTTGTTATGTGAAAGGTTAGGCACTGTTCCTAACAGAAAACAGGT
GGGGTCGAATTAGCCCTGAAGGGTCTGACGCTTACAAGAGTGAGCTGGCTGCATTTAAAATGCATGCTTTTCTCTGAAGT
CCTGTCAGAATGGCCTGAGCCACACGTGCCCAGTTAAGGGGGAGCAGGAATTTNATATTCTACCTGAGTTGCATTTCCTA
NTGTGAAANCNAAACANGATGANCCTGANGAGGCCACTTCTACCTGCCTTGTNANCN
Sequence Type genomic DNA
Unitrap ID UNI23572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20143542..20143913 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]


Sequence tag IST14710H10BBF1
Sequence
AAAGTATAGGTGTGGAAAGAAACTTGTGTTTGTGTATGTATCAAGTGATAGGAGTCACACAAAAACTAATACTGCTTGCC
TGTGTTTGTGGGACTGTTCAGTGGGAAATACTTGGCTTGTTATGTGAAAGGTTAGGCACTGTTCCTAACAGAAAACAGGT
GGGGTCGAATTAGCCCTGAAGGGTCTGACGCTTACAAGAGTGAGCTGGCTGCATTTAAAATGCATGCTTTTCTCTGAANT
CCTGTCANAATGGCCTGAGCCACACGTGCCCAGTTAAGGGGGAGCAGGAATTTCATATTCTACCTGAGTTGCATTTCCTA
GTGTGAAAGCCAAACAGGATGAGCCTGANGAGGCCACTTCTACNTGCCTTGTCAGCTTCTAGTCTCTGANGAAAATGANG
CTGTTCCTGTCCAGGTTTTANTTTTGANGTNANTCCCNGTGCANGTGACTGCNCACNCTCCNTGCGCACNGNTNCCNTGN
NCCCNNNTNCATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es