Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120F04
Clone ID M120F04
Vector ROSAbetageo0
Project ggtc

Sequence tag M120F04
Sequence
CGGTCGCATTCGGAGTGAGACGTCGAGGTGAGCGATCGCAGCGGAGAACGAGATGCCGGTGGCCGTGGGTCCCTACGGGC
AGTCCCAGCCCAGCTGCTTCGACCGCGTGAAGATGGGCTTCGTCATGGGTTGCGCAGTGGGTATGGCGGCCGGGGCGCTG
TTCGGCACCTTCTCCTGTCTCAG
Sequence Type mRNA
Unitrap ID UNI11460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155969970..155970325 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067847 (2010100O12Rik) NM_025946 reactive oxygen species modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914317]

 
Come back to gene ENSMUSG00000067847


For any suggestions or comments, please send an email to unitrap@crg.es