Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14669F11
Clone ID IST14669F11
Vector VICTR74
Project tigm

Sequence tag IST14669F11HMR1
Sequence
TGCCCCTTCCTAATTTCCCTGGTTCTCAAATGCCTTTTGTATTGTGATGCCTGCCTGTTCCCTGGTTTTTCCCCTGGGTC
CTGCTTACCCCCTTGGAGTAGCCAGTTGTCAGGTANGGAAGGGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43570635..43570761 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]


Sequence tag IST14669F11HMF1
Sequence
CAGAGGAAAAAGGGATTGGGAAAGGTGGATCAATGACCAGGAGGAAATTTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43570760..43570816 57
NO GENE  


Sequence tag IST14669F11BBF1
Sequence
CAGAGGAAAAAGGGATTGGGAAAGGTGGATCAATGACCAGGAGGAAATTTCTGGCCNTACACACAGTTCAGGATTACAGA
GAAAAGCAGCATGGCTTGTTCTCCATTTTTACCCCAAATGAGAGGACCTCCCGGCCCCCTCAGTCCCAGCTCTCTCCCTT
CCTTCCCCCTAGGGAACCTTCCCAGCAGTGGACAGACCTGGCTGTGGAGTGAGGGCTGGTCAGANAAGCACCAGTCCNCG
GAACCNNANCAGTACTGANNGACTCCAGCCTCAGCTGAAACTGCNTGTGTGCCCCTCCGCCCCCATTTCCTCCGGACATA
TGGATACCCACTTCTTCNTNNGGNNANANCCTGATANNAGAGTTGANTCATGCCTGCNCTNNTNCANGCTGANTANCTAT
CN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es