Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14201B9
Clone ID IST14201B9
Vector VICTR74
Project tigm

Sequence tag IST14201B9HMR1
Sequence
NCGTGATTCCACTGCTTCTGGATCCATTGATTTGAGTTGGTGATACTGTTGGGTCAAAACCAGGGCCTGCACCACCGAAA
TTCTGTCTTTTACAAACTGGACCAAGCGGTTGAGAGTACAGGGTCCGAGGAGTANGATTAATAAAAGTATTATCAAGGGG
CCCATAATGGTGGATATCAAGGTCNTGAACCATGGGGACCTGTTAAACAGTCCCTCAAACCACCCTTGTCCTGATTNNAC
ANNTNNNNNNNNNNNAGCGGTGGGGGTGGTCN
Sequence Type genomic DNA
Unitrap ID UNI30769 UNI30770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62293074..62295085 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041729 (Coro2b) NM_175484 coronin, actin binding protein, 2B Gene [Source:MGI (curated);Acc:Coro2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61001825..61003833 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003228 (Grk5) NM_018869 G protein-coupled receptor kinase 5 Gene [Source:MGI Symbol;Acc:MGI:109161]


Sequence tag IST14201B9BBF1
Sequence
CCGCGAAACAGGGCACTTGGTTCACAAGGACCGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29231348..29231386 39

 
Come back to gene Mm.472490


For any suggestions or comments, please send an email to unitrap@crg.es