Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14525F7
Clone ID IST14525F7
Vector VICTR74
Project tigm

Sequence tag IST14525F7BBF1
Sequence
CATAGTACCAGGAAATAATCCATGCCCGCCTCACATTGGGGGTGGGAAATATAGTCAACATTTATGGCTTCTATTCTGAC
ATGCTTAAAATTAATGAATAAAGTTTGGCAGACCAATTACCTCACAGAGGAACCGCGCCCTAGGAAGCCAGGTGCACCTG
AAGCCAGGCTAATAGGACAGGAGGAGTAACTGGCCCTTTAAGAAAGTGATGACAGGGATTGGGGATTTAGCTCAGTGGTA
NAGTACTTGCCTAGCANGCATAAGGCCCTGGGTTTGGTCCTCAGCTCTGGAAAAAAGAAAAAGAAGATGATGGCCTTTTC
CTGCCTCGTGGTACAGGCACTCACAGACTTANNNACTGN
Sequence Type genomic DNA
Unitrap ID UNI30739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25680987..25681344 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST14525F7HMF1
Sequence
CATAGTACCAGGAAATAATCCATGCCCGCCTCACATTGGGGGTGGGAAATATAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25680987..25681042 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST14525F7HMR1
Sequence
CTATGCAGCTGTCTTACATCTGTACACCCTCATGAAGCACACGCGGTCACCCATCTATGTAGCAGTTGTCAAAACAATAG
TCTAGAGGCAAGAAGGTCATTGCCAGGCTCCAGGAGGCTTANAGAAGAGGGCTTGGCAAAGCCTAGACACAAACCTTGGA
TGGATTTCTGTTTCCTCCCATACTTTTCAGGGCTTCGGTGCCTGATCNGCCTTGGCTTTCAGGCAGCCGGACTGGGGTGC
ATGTGAATGTGTGANACCNGAGCTCTGTACCTCCCANAGCAATGAGGTTANACCTCANAGTCCCGGACACAGGATGAATG
ACCCANTGGCTACNGGCAACAGAAGCTGANGCCCANGCGAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25680630..25680991 340
NO GENE  

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es