Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14581D12
Clone ID IST14581D12
Vector VICTR74
Project tigm

Sequence tag IST14581D12BBF3
Sequence
AAAACAAACGTTAAAATGAAGCAGAAGGCTGCACAATGAGGTTCGTTGGATGCGACACTTCTGAGTTACCCTAAATTTCC
CAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGAAGGATTCGGTCACAGGTATCTCAACCACCTCGGNNG
GTGCAAGATGCACGCGCGGGGCAGTTCCTCCTGTTCAGAACACTCAGCCCACAGCTGACTCCCACTTCCGTACGATAACG
CAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCGGCTTCCGGTTTTCCCGGCAGCGTCCCGCGTGGCTGC
CGGGGCCNCGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGCCTTANGGACCTGGCTGTCCAGTGAGTGANTGTGGGG
TTGGGGACACNGNANCCNCGGGGCNACNNNCCCTCTAN
Sequence Type genomic DNA
Unitrap ID UNI32048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55045414..55045850 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]


Sequence tag IST14581D12HMF2
Sequence
NNNNNAAACGTTAAAATGAANCANANNGCNGCACAATGANGTTCGTTGGATGCNACNCTTNNGANTTACCCTAAATTTCC
CAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACNGCTGCNAANGATTCNGTCACAGGTANCTCAACCACCTCGGANG
GTGCANNATGCNCNCGCGGGGCANTTCCTCCTGTTNNNAACANTCNNCCCNCANCTGACTCCCACTTCNGTACNATAACN
CAANANGGTGGGACCGGCNATTGANAACCACATTCAANATGTCGGCTTCCNGTTNNCCNGGCANCGTCCCGCGTGGCTGC
CGGGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es